Method of diagnosis of colorectal cancer
Authors | |
---|---|
Year of publication | 2020 |
Type | Patent |
MU Faculty or unit | |
Publisher | European Patent Office |
State | Germany |
Patent's number | EP3431609B1 |
web | odkaz na stránku Evropského patentového úřadu |
Description | The present invention relates to a method of diagnosing and prognosing colorectal cancer using piRNA-hsa-5937, having the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker. The biomarker can be combined with other piRNAs or miRNAs. The resulting method uses a body fluid as the input, and therefore is non-invasive, has a high sensitivity and specificity even in very early stages of the disease, and is cost-effective. |
Related projects: |